Locating Restriction Sites

Rosalind Problem

Given: A DNA string of length at most 1 kbp in FASTA format.

Return: The position and length of every reverse palindrome in the string having length between 4 and 12. You may return these pairs in any order.

Sample Dataset

>Rosalind_24
TCAATGCATGCGGGTCTATATGCAT

Sample Output

Python Playground


    dna = '''>Rosalind_24
    TCAATGCATGCGGGTCTATATGCAT
    '''


    # dna is given as input FASTA
    # Write your code here


    ans = '''4 6
    5 4
    6 6
    7 4
    17 4
    18 4
    20 6
    21 4
    '''
    Ex().has_output(ans)
    success_msg("Great job!")